homodimer simulations fail using DINAmelt

5 replies [Last post]
amdurbin
Offline
Joined: 04/01/2011

http://mfold.rit.albany.edu/results/110401/105221/index.html

Homodimer simulations

Job Name: betag8

Model: Energy Minimization

Sequence 5'--3':

GAATTCAGGAGGAATTTAAAATGGGGGGAGATTCAGAACGTCACTTTGTACATCAATTCA

NA type: RNA

Exclude species: AA

error message:

betag8 failed.
[Fri Apr 1 10:52:21 2011] hybrid2.cgi: Use of uninitialized value in pattern match (m//) at /network/rit/www/mfold.rit.albany.edu/cgi-bin/DINAMelt/hybrid2.cgi line 108.
Can't locate object method "new" via package "Mail::Mailer" (perhaps you forgot to load "Mail::Mailer"?) at /network/rit/www/mfold.rit.albany.edu/bin/hybrid2-work.pl line 161.
Calculating concentrations for 100
Calculating concentrations for 101
Calculating concentrations for 102
Calculating concentrations for 103
Calculating concentrations for 104
Calculating concentrations for 105

zukerm
Offline
Joined: 11/12/2010
Job failures on the DINAMelt web server - "hybrid2" applications

The errors that occurred were caused by a faulty Perl script that had not been updated since the relocation of the web server from RPI to the RNA Institute. The problem has now been corrected. Please submit another homo-dimer or hetero-dimer job to the DINAMelt server and include your E-mail address. You should receive an Email notification that your job has run and a URL pointing to the results.

Once more, thank you for bringing our attention to this problem.

admin
Offline
Joined: 09/23/2010
Thank you for letting us

Thank you for letting us know. We'll look into this as soon as possible.

PS: I'm moving the topic from "Software" to "Website".

admin
Offline
Joined: 09/23/2010
Thank you again for bringing

Thank you again for bringing this to our attention. We're in the process of fixing this. For now, if you just enter your information without adding an email address, it should work fine.

sireedisson
Offline
Joined: 09/15/2011
Not sure if this is a big but

Not sure if this is a bug but when I click the 'create content button' it does not seem to take me anywhere or give me further options?

Also - something I just noticed. When creating a new message you have to click preview, which then requires you to type in the CAPTHA again? So you always need to do it twice. Again not a major issue but a small bug.

admin
Offline
Joined: 09/23/2010
The link to create a forum

The link to create a forum topic should appear above the create content button. Is this not appearing?

I've eliminated Captcha for forum posts. It seems a bit redundant anyway.