mfold with empty save file

3 replies [Last post]
tsznxx
Offline
Joined: 10/09/2013

I installed mfold3.6 like this:
tar -zxvf mfold-3.6.tar.gz
cd mfold-3.6/
./configure --prefix=$HOME/local
make
make install

After installation, I can find the mfold in $HOME/local/bin, and can find $HOME/local/share/mfold directory.

The files I am using:
test.fa:
>YBR177C
UGUCAGAAGUUUCCAAAUGGCCAGCAAUCAACCCAUUCCAUUGGGGAUACAAUGGUACAGUUUCGCAUAUUGUCGGUGAAAAUGGUUCCAUUAAACUCC
test.cons:
F 20 0 3
F 27 0 1
F 31 0 2
F 52 0 2
F 61 0 3
F 83 0 1
F 86 0 2
F 96 0 2
P 0 0 1
P 9 0 1
P 18 0 1
P 29 0 1
P 45 0 1
P 71 0 1
P 90 0 4

When I ran the mfold like this:
mfold SEQ=test.fa AUX=test.cons

I got errors like this:
mfold version 3.6
REUSE= NO
Constraint file is test.cons
test.fa.pnt created.
Sequence length is 99
Folding at 37 degrees using version 3.0 dat files.
Save file created using nafold.
Save file is empty. No foldings.
Job Aborted

Then I tried to fold this sequence in the mfold webserver, it worked very well and provided two candidate structures.

There has been a few posts asking the same question, but I didn't figure out the solution from the reply. So I asked again.

Looking forward to your reply! Thanks.

jayaramanp
Offline
Joined: 08/04/2014
Save file created using nafold. Save file is empty. No foldings.

I installed the version 3.6 for mfold on a centod server and ran the installations from source using
./configure --prefix=$home/mfoldExce/
make
make install

and i had similar problems wherein it wouldnt create any of the files.
On checking the log files i realized that newtemp faied in opening the asint1x2 data files. and the error was Error opening asint1x2._

when i checked newtemp.f under scripts, i found that the variable "path" was hard coded to /usr/local/src/mfold/share/mfold

i changed it manually. Hopefully in future this will make sure the path variable is changed to the location where i have installed my /bin and my share folders.

Hope this helps!

regards,
Pushkala

tsznxx
Offline
Joined: 10/09/2013
Fixed it!

I finally figured out the reason. I tried install mfold in different machines, Fefora, redhat, cent OS, mac os and unbuntu, and found it worked in the redhat system. I them compare the the difference and figured out: The libgd library should be installed before installing mfold.

I don't know why the mfold program didn't tell me about this in the README/INSTALL instruction files. The program was successfully compiled without raising any errors.

Anyway, it works well now. I tested this in multiple platform and found it worked. Hope this helps.

prachi1627
Offline
Joined: 12/13/2013
need help

how u corrected the error? can u discribe me