Reporting web site problems

3 replies [Last post]
zukerm
Offline
Joined: 11/12/2010

Users sometimes inform us that their submitted jobs did not run or that they did not receive an Email notification upon completion. Please help us by giving as much information as possible. What were the unique URLs of the jobs that failed or that gave mysterious results? If you don't remember, send us the actual sequences that were submitted. By supplying such detailed information, you enable us to track down what went wrong.

Kenshi Hayashi
Offline
Joined: 05/15/2016
m fold in a batch

I have ~20 DNA sequences (length 60 - 150), that I hope to examine by m fold. Are there a way to do this in a batch? All parameters except sequences and high light positions are variable.

Zoven
Offline
Joined: 05/17/2012
Jobs aborted!

I'm a postgraduate, working on RNA structrure. Mfold is preferred when predicting DNA or RNA secondary structure. But my jods are always aborted. Strangely when I clicked on the "folding results" button, I can see that many jods had been submitted. Some of them are mine, the others are not. I don't know what's it. Can you tell me why and how I can solve this problem?
Followed is my job submitted more times and aborted at last:
>BMB171_C0936 1051651-1057827
aaccggacggtctttttttgttatataaatataaaaaataggagggaactatgcaaatga
aaagtactaaaagacatatttcaatggtttcattagtttttctagtattattttcagtgc
tgaatgtgtgggctccagttattcaagctgctgtgatgaaaagtccagtggacgaaatta
atatttcccgtactgatggcacgacatctgaaccgtatcaagcctcagatggtatgaaag
tagaagtgaagtggtcagctaaagaaaaaataaaaagtggagatcaattcacaattgata
tgccaaaagagtttcgaaaagaccttatgaatatgagttttcctttaaaagatgctgaag
gaaaaacagttggtacatgtgagatgaaaaagggtctattaacgtgtactatgggggatt
acgtagaaggaaagaataacattaaaggttctttattcgtagaattctactttggtctag
aagcatatgatggtgttaaagaaattccattagaatttaacgttgatggtcaaatcgtca
ataaagaagtaaatgtaagtaatacgacagagagaccgaagccacagcccaatacagata
atctattgaaatggggttcttataatcaagaagatccttcgattgctgattggcttgtat
atgtaaatgcaactggaacagaaatgcaagatcttaaattaacagatacattaggacctg
ggcatgagttaattacagacagcgtagtattagaagaggctgtatttgaagatggttatg
caccaacaaatattaagccagcagatttatctaacattaaaattaatgcaacaaaggctg
gatttacaattgagtttccagacagttcaaaaggttatattttaagatataaaacaaaga
ttactaatccttctgcaaagcctcataaaaatactgtgaaattagaaggtaaaaatatta
aaactgaagaaaaagtaggacaagtattcgtaagtggtggagggggaaccggttcaggtg
acgataatccacctagtattgaaaaaaatatagttgatgagaatggcaagcttgtagaga
atgagcagctaacacaaatggatcaagtgattcaataccaagttggtacacatataccaa
acgatcctcctaaatacacatcaatggtaattcgtgatgatttagaagatgttttagaag
tattagaggcaaaagtgtatgatcaaaatggccaagatattacttctaaaggaacgttaa
agatagataagcaaagaagtgaagtaacatttacgtttagtgagaattttgactataagt
catatgaagaccagagaatcaatcttagtatcaaggcgaaaattaaaaataatgcagact
tatcttcttacgtagataagaagattcctaataaagcggaattacattttgatgataaaa
cattaacatcaaaagaagtaactattacgccgcctgaagctccaaaagacggtacagtat
cgattcataaaatagattctgagaatccgaacaaagggttaaaaggtgccgaatttgaag
ttcgaaatagtacaaacgaagttgttgcaaaactgaaaacggacgaaaaaggtttttcag
tacctcaaactttagctcctggaacgtataaagtttatgaaacagtagcaccagaaggat
atcaaaaattaaaagaaccagtagaggttacacttcaagctggagaaacaaaaacaattg
aaattaaaaatactatgcaaaagggtcaaattgaagtaaagaaaattgattcggaaaatg
gtgaaaaaccattagcaaatgcagagtttgatatagtaaaagacggtgtagtagtcgaac
atattgttacagataaagatggtaaggcaatctctaaaccgttagcaccagggaaatata
ttttaaaagaaacgaaagcgcctgaaggctaccaattaaaagaagcagagttcgaagtaa
atgtaacaggggacggcatattcccaatacaagtggaaaatgcaatggtagacaaaggta
atatagaaattacaaaagtggacaaagaaaacggagcagtattagcgggtgtcgaatttg
aagtccaagatgagaaagatgaagtagtaagaaaagtagtaacagataaagatggaaaag
caaacgtttcagatctatcagtaggaaagtacaaattagtagagacaaaaagcttaccag
gttataaaaagctaacagaaccagtaccatttgaaataaaaaaaggtatgacaaaagctt
tagcaataaaagtagaaaatgagcagttagacaaaggctcagtagaaattacaaaaatag
ataaagatagccaaaaagtactagaaggcgtagtcttcgaagtgcaagatgagcaaggca
aagtagtaacagaagtaaaaacagataaagatggtaaagcaaaaatctctgatttatcag
tagggaagtacaaattagtagagacgaaaagtttaccaggctacaaaaagctaacagatt
cagtatcattcgaaattacaaaaggtatgacaacagtcctatcgttgaaagtagaaaatg
aacagttagataaaggttcagtagaaattacaaaaatagataaagacagcaaaaaagcat
taaaaggcgtagtctttgaagtgcaagatgaagctggaacagtagtaaaggaagtaaaaa
cagataaagatggtaaagcaaaaatctcagatctatcagtaggaaagtacaaattagtag
agaaagaaagtttaccaggctataagaaattaacagagccagtatcgtttgaaattacaa
aaggtatgaccgagatcttatcattaaaaatagaaaatgaaatggtagatacgggaaata
tagagataacaaagatagataaagataataaagcaccgttagcgggagtaacattcatcg
tacaagatgaaaagggtaaggaagttacgaaagtaacgacagataaagaaggaaaagcaa
atgtttcagatttacctgtaggaaagtatgaattagtagaggtagaaagtttacctggtt
ataaaaagttagaaaaaccagtatcatttgaaattaaaaaaggcatgactgaggttctat
cattaaaagtagaaaatgaaatggtggatacagggaatgtagagataacaaaaatagata
aagatagtaaagctccattagaaaatgttgtatttgaagtacgtgattcaaaaggaaaag
tagttgcaaaagtaacgacggataaagaaggaaaagcaaacgtttcagatttacctattg
gaaagtatgagttagtagaagtagaaacaccggcaggatacaaaccactagaaaagccaa
tttcattcgaaattgaaaagggtagagtaacagcgctaaagctaacagtagaaaatgaat
tagtggatacaggaaatgtagaaattacaaaagtagataaagaaaataaagatgctttag
ctgatgcagtatttgagattcaagatgaagcaggacaagtagtcgctaaaataacgacag
ataaaaaaggacaagcacaagttactaatttatcagtcggcacatacaagttagtagaag
taaaggcaccaaaagggtataaacaattagtagatccgattactttccaaattgaaaaag
gcatgacaaaatctcttgctttaacagtagaaaacgaaatgttagacaagggaaatgtgg
aagtaacaaaagtagataaagatagtcaaaaagtattagaaggcgtagtcttcgaagtac
aagatgagcaaggcaaagtagtaacagaagtacaaacagataaaaatggtaaagcaaaaa
tctcagacttatctgtaggaaagtacaaattagtagagaaagaaagcttaccaggctaca
aacaattaacagaaccagtatcattcgagatcaaaaaaggtatgacgaaagttttatcat
tgaaagtagagaacgaacagttagataaaggttcagtagagattacaaaagtggacaaag
aaagtggcgcagtattagcgggcgtaacattcgaagtgcaagatgaaaaggcaaagtagt
aacaaaagtaacgacagataaagaaggaaaagcgaaaatttcagatctatctgtagggaa
ttacaaactagtagaagtagaaagcttaccaggctacaaaaagctaacagagccagtatc
attcgaaactaaaaagggtatgacagaagtcttatcattaaaagtagagaatgaacagtt
agacaaaggttcagtagaaatcacaaaagtagataaagatagtcaaaaagtattagaagg
cgtagtcttcgaagtacaagacgacaaaggcaaagtagtaacagaagtaaaaacagataa
aaatggtaaagcaaaaatctcagacttatctgtaggaaagtacaaattagtagagaaaga
aagcttaccaggttacaaaaagctaacagagccagtatcattcgaaattaaaaaaggtat
gacagaagtcttatcattaaaagtagagaatgaacagttagacaaaggttcagtagaaat
cacaaaagtagataaagatagccaaaaagtattagaaggcgtagtcttcgaagtacaaga
tgagcaaggcaaagtagtaacagaagtaacgacagataaagatggaaaagtaaacatttc
agacttatctgtaggaaagtacaaattagtagagaaagaaagcttaccaggttacaaaca
attaacagaaccagtatcgtttgaaattaaaaaaggtatgacagaagttctatcattaaa
aatagaaaatgaaatggtagatacgggaaatgtagaaattacaaaaatagataaagataa
taaggcaccgttagcaggtgtagtctttgaagtacaagacgacaaaggcaatgtagtaac
gaaagtaacgacagataaagctggaaaagcaacagtttcagatttatcagtaggaaagta
caagctagtagaagtagagcgtttaccaggctacaaaaaattagaaaagcctgtaccatt
tgaaattacaaaaggtatgacaaaatctttagcgttcactgtagaaaatgaaatggtaga
tacggggaatgtagaaatcacaaaaatagataaagacagtaaagcaccattagaaaatgt
tgtatttgaagtacgtgactcaaaaggcaaagtagttgcgaaagtaacgacggataaaga
aggaaaagcaaacgtttcagatctatcagtaggaaaatacaaattagtagagacgaagag
cttaccaggttacaaaaagttaacggaaccagtatcattcgaaattacaaaaggtatgac
aaaagtcttatcattgaaagtagagaacgaacagttagacaaaggtgcagtggagattac
aaaaatggccgctgaaagcaaggaagtcttatcaggagctgtgtttgaagttcatgatga
aaagggaaaagtagtagtgaaagtaacaacagataaagatggaaaggcaaaaatcacaga
tctatctgtaggtaactacacactagtagaagtagaagcaccaaagggatatgaaaaatt
aactaatccaattccatttgaaattacaaatggaatgataaatgcagttcaattagaagt
attaaacaaattgaatcatttagcaccaccaggtccagaaacaccagatccagaaaagcc
tggaacaccagatccagaaaaacctggaacaccagatccagaaaaacctggaacaccaga
tccagaaaagcctggaacaccagatccagaaaaacctggaacaccagatccagaaaaacc
tggaacaccagatccagaaaagcctggaacaccggatccggagaaacctggaacaccgaa
tccagaaaaacctggaacaccagatccagaaaagcctggaacaccggatccggagaaacc
tggaacaccgaatccagaaaaacctggaacaccagatccagaaaagccagggacaccgaa
tccagagaaacctgaaaaagaattaccgaagacagggcagaaaatgcctgtggaaccata
tatgggagcacttcttgtaatgatgagttttgggttactcgtattaggtagaaaacagca
gagataataaaggtgaaaaggtatcctcaaagtatttgaggataccttttttagcat

admin
Offline
Joined: 09/23/2010
That's strange. What form are

That's strange. What form are you using? I tried entering the sequence in the RNA folding form, and everything seemed fine (though there are some issues with the templates). Try again today and let us know if you're still having problems.