Difference between online RNA folding form and hybrid-ss-min on UNAFold 3.8

1 reply [Last post]
garggie
Offline
Joined: 06/12/2013

Hi, I'm a PhD student working on RNA structure. I find that for the same sequence, when I use the online RNA folding form (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form), and use hybrid-ss-min UNAFold 3.8 installed on our lab server, the results turn out to be very different. I think the parameters I used are the same:

My sequence:
GGGGGCGUCACGGUUUCGACGGGAUUGACUGCGGCAAAGAGGCAUGCCGG
GGGGUGGGCACCCGUAAUCGCUCGCGCCAACAACAAUCUGGCACUCGCAG
CUUAUUAAAUAAGUUGCCGUCCUCUGAGGCUUCGCCUGUGGGCCGAGGCA
GGACGUCAUACAGCAGGCUGGUUCCUUCGGCUGGGUCUGGGCCGCGGGGA
UGAGAUCCACGGACUAGCAUUCUGCGUAUCUUGUCGCUUCUAAGCGCAGA
GUGCGAAACCUAAAGGAAUGCGACUGAGCAUGGAGUCUCUUUUCUGACAC
CAAUUUCGGACGCGGGUUCGACUCCCGCCGCCUCCACCA

RNA Folding Form:
All parameters are default except percent of suboptimality = 5.3%, and window size = 4

Results from the RNA folding form:
Circular structure Plots

◈ Structure 1 : Initial ΔG = -137.80 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 2 : Initial ΔG = -137.80 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 3 : Initial ΔG = -137.70 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 4 : Initial ΔG = -137.30 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 5 : Initial ΔG = -137.20 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 6 : Initial ΔG = -136.90 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 7 : Initial ΔG = -136.90 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 8 : Initial ΔG = -136.30 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 9 : Initial ΔG = -136.00 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 10 : Initial ΔG = -135.90 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 11 : Initial ΔG = -135.80 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 12 : Initial ΔG = -135.60 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 13 : Initial ΔG = -135.60 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 14 : Initial ΔG = -135.40 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 15 : Initial ΔG = -135.40 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 16 : Initial ΔG = -135.40 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 17 : Initial ΔG = -135.30 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 18 : Initial ΔG = -135.20 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 19 : Initial ΔG = -134.80 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 20 : Initial ΔG = -134.80 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 21 : Initial ΔG = -134.60 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 22 : Initial ΔG = -134.60 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 23 : Initial ΔG = -134.20 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 24 : Initial ΔG = -133.90 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 25 : Initial ΔG = -133.80 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 26 : Initial ΔG = -133.40 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 27 : Initial ΔG = -133.20 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 28 : Initial ΔG = -133.10 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 29 : Initial ΔG = -132.90 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 30 : Initial ΔG = -132.80 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 31 : Initial ΔG = -132.70 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 32 : Initial ΔG = -132.50 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 33 : Initial ΔG = -132.10 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 34 : Initial ΔG = -132.10 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 35 : Initial ΔG = -132.00 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 36 : Initial ΔG = -131.90 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 37 : Initial ΔG = -131.90 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 38 : Initial ΔG = -131.90 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 39 : Initial ΔG = -131.80 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 40 : Initial ΔG = -131.80 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 41 : Initial ΔG = -131.70 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 42 : Initial ΔG = -131.60 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 43 : Initial ΔG = -131.60 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 44 : Initial ΔG = -131.60 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 45 : Initial ΔG = -131.50 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 46 : Initial ΔG = -131.40 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 47 : Initial ΔG = -131.30 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 48 : Initial ΔG = -131.20 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 49 : Initial ΔG = -131.20 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

◈ Structure 50 : Initial ΔG = -131.10 kcal/mol, (Thermodynamic Details).
Different file formats: PostScript, pdf, png, jpg, .ct file, Vienna, RNAML, RnaViz ct, Mac ct, RNAdraw, XRNA ss.

hybrid-ss-min @ UNAFold 3.8:
hybrid-ss-min --mfold=5.3,4,1000

results from hybrid-ss-min @ UNAFold 3.8 (dG in ct file):
339 dG = -114.1 Acibm_capsu 339 bases
339 dG = -114 Acibm_capsu 339 bases
339 dG = -113.6 Acibm_capsu 339 bases
339 dG = -113.6 Acibm_capsu 339 bases
339 dG = -113.5 Acibm_capsu 339 bases
339 dG = -113.5 Acibm_capsu 339 bases
339 dG = -113.4 Acibm_capsu 339 bases
339 dG = -113.2 Acibm_capsu 339 bases
339 dG = -113.2 Acibm_capsu 339 bases
339 dG = -113.2 Acibm_capsu 339 bases
339 dG = -113 Acibm_capsu 339 bases
339 dG = -113 Acibm_capsu 339 bases
339 dG = -112.9 Acibm_capsu 339 bases
339 dG = -112.7 Acibm_capsu 339 bases
339 dG = -112.7 Acibm_capsu 339 bases
339 dG = -112.5 Acibm_capsu 339 bases
339 dG = -112.2 Acibm_capsu 339 bases
339 dG = -112.1 Acibm_capsu 339 bases
339 dG = -112 Acibm_capsu 339 bases
339 dG = -111.3 Acibm_capsu 339 bases
339 dG = -111.3 Acibm_capsu 339 bases
339 dG = -111.2 Acibm_capsu 339 bases
339 dG = -111.2 Acibm_capsu 339 bases
339 dG = -111.2 Acibm_capsu 339 bases
339 dG = -111.1 Acibm_capsu 339 bases
339 dG = -111.1 Acibm_capsu 339 bases
339 dG = -111.1 Acibm_capsu 339 bases
339 dG = -111 Acibm_capsu 339 bases
339 dG = -110.9 Acibm_capsu 339 bases
339 dG = -110.9 Acibm_capsu 339 bases
339 dG = -110.8 Acibm_capsu 339 bases
339 dG = -110.7 Acibm_capsu 339 bases
339 dG = -110.6 Acibm_capsu 339 bases
339 dG = -110.6 Acibm_capsu 339 bases
339 dG = -110.2 Acibm_capsu 339 bases
339 dG = -110.2 Acibm_capsu 339 bases
339 dG = -110.1 Acibm_capsu 339 bases
339 dG = -110 Acibm_capsu 339 bases
339 dG = -109.9 Acibm_capsu 339 bases
339 dG = -109.9 Acibm_capsu 339 bases
339 dG = -109.8 Acibm_capsu 339 bases
339 dG = -109.8 Acibm_capsu 339 bases
339 dG = -109.8 Acibm_capsu 339 bases
339 dG = -109.7 Acibm_capsu 339 bases
339 dG = -109.7 Acibm_capsu 339 bases
339 dG = -109.7 Acibm_capsu 339 bases
339 dG = -109.6 Acibm_capsu 339 bases
339 dG = -109.6 Acibm_capsu 339 bases
339 dG = -109.5 Acibm_capsu 339 bases
339 dG = -109.5 Acibm_capsu 339 bases
339 dG = -109.5 Acibm_capsu 339 bases
339 dG = -109.5 Acibm_capsu 339 bases
339 dG = -109.4 Acibm_capsu 339 bases
339 dG = -109.4 Acibm_capsu 339 bases
339 dG = -109.4 Acibm_capsu 339 bases
339 dG = -109.3 Acibm_capsu 339 bases
339 dG = -109.2 Acibm_capsu 339 bases
339 dG = -109.2 Acibm_capsu 339 bases
339 dG = -109.2 Acibm_capsu 339 bases
339 dG = -109.2 Acibm_capsu 339 bases
339 dG = -109.1 Acibm_capsu 339 bases
339 dG = -109 Acibm_capsu 339 bases
339 dG = -109 Acibm_capsu 339 bases
339 dG = -109 Acibm_capsu 339 bases
339 dG = -108.9 Acibm_capsu 339 bases
339 dG = -108.9 Acibm_capsu 339 bases
339 dG = -108.9 Acibm_capsu 339 bases
339 dG = -108.8 Acibm_capsu 339 bases
339 dG = -108.8 Acibm_capsu 339 bases
339 dG = -108.7 Acibm_capsu 339 bases
339 dG = -108.7 Acibm_capsu 339 bases
339 dG = -108.7 Acibm_capsu 339 bases
339 dG = -108.7 Acibm_capsu 339 bases
339 dG = -108.6 Acibm_capsu 339 bases
339 dG = -108.6 Acibm_capsu 339 bases
339 dG = -108.6 Acibm_capsu 339 bases
339 dG = -108.6 Acibm_capsu 339 bases
339 dG = -108.5 Acibm_capsu 339 bases
339 dG = -108.5 Acibm_capsu 339 bases
339 dG = -108.4 Acibm_capsu 339 bases
339 dG = -108.4 Acibm_capsu 339 bases

Could you please take a look if there is anything wrong? Thank you!

zukerm
Offline
Joined: 11/12/2010
The answer is simple. You

The answer is simple. You folded your RNA sequence using two different programs and two different sets of energy parameters!

The mfold application on the UNAFold web site uses the old nafold program from the mfold package. hybrid-ss-min is a program that, when run using the "--mfold" flag, gives equivalent output. I computed secondary structures using both nafold and hybrid-ss-min with the --mfold flag and got free energies that are almost identical. I did not check the actual structures, but I assume they are identical or close to identical. This is the best that can be expected given that although the algorithms are the same, they differ in very slight ways and the free energy parameters differ in slight ways for reasons that I won't bore you with.

So, the problem is not that you used two different programs but that you used totally different free energy parameters! By default, the nafold program uses the "version 3" RNA parameters that are fixed at 37 °C. However, by default the hybrid-ss-min program uses the very old version 2.3 energy parameters where the temperature can be varied. The default temperature is 37 °C. Both programs assume that the nucleic acid is RNA (not DNA) by default. To duplicate the first results you would have to add the flag: --suffix=DAT (or the short form "-s DAT") when you run hybrid-ss-min. That is why you got such different answers. There is a special form available with the mfold application on the UNAFold web site that allows you to fold with the old version 2.3 energy rules. Just use this link. I don't recommend that you use the old energies unless you want to fold at different temperatures.

This is not a good situation and we are to blame for the confusion, even though the man pages and documentation state what I have just written. It's a problem that arose when the UNAFold software was created and we used slightly different defaults. UNAFold version 4 has just been created and it introduces new energy rules. As soon as this new software is released, it will be used exclusively on the UNAFold web site for all predictions. I will keep the mfold application for those who wish to duplicate old results. This will remove the problem you encountered.