Error in running mFold

2 replies [Last post]
rayarjun
Offline
Joined: 08/24/2017

Dear all,

I am getting the following error for my sequence.

Input file:
>Sequence
TGATTTAAAAGGAAAAACTTGAACAAATGGACAATATGTCTATTACGAATACACCAACAAGTAATGATGCCTGTCTGAGCATTGTGCATAGTTTGATGTGCCATAGACAAGGTGGAGAGA

arjun@matrix:~/temp/Megha$ mfold_quik SEQ='test.file' NA=DNA
mfold version 3.6
newtemp failed
Job Aborted
arjun@matrix:~/temp/Megha$ vim test.file
arjun@matrix:~/temp/Megha$ mfold_quik SEQ='test.file' NA=DNA
mfold version 3.6
newtemp failed
Job Aborted

The log file shows: /usr/local/bin/mfold_quik: line 127: newtemp: command not found

I am getting the following files created:

test-local.seq
test.pnt
test.log

Can someone please help in solving this?

Thanks

Arjun

zukerm
Offline
Joined: 11/12/2010
folding error

You have not installed mfold properly. The 'newtemp' program should be in your exec pathway.

zukerm
Offline
Joined: 11/12/2010
folding error

You have not installed mfold properly. The 'newtemp' program should be in your exec pathway.