Quite different results for the same structure from mfold to vienna rna package

2 replies [Last post]
ej
Offline
Joined: 12/30/2015

Here is the sequence: GGUGCAUCGAUGCAGGGGGGUGUGGUUUUUUUUUGG
mfold predict the mfe is: ............((((((((.......)))))))).
The free energy is :-4.10

I input the same sequence and the structure in http://rna.tbi.univie.ac.at/cgi-bin/RNAeval.cgi
The free energy is :-1.60
Also vienna rna package predict a quite different mfe structure.

I looked into the energy computation and found out that the difference comes from the energy of the hairpin loop. Can you elaborate how mfold compute the energy of the hairpin loop of the above sequence?

Thanks in advance:)

mbgood123
Offline
Joined: 06/30/2016
Free Energy

Sorry i have some doubt with the free energy. Why it is varying from -4.10 to -1.60

Thanks
Rake
Official Site

felixwilliams
Offline
Joined: 11/08/2015
quiet obvious, result will

quiet obvious, result will differ due to the change in the energy...

ufo pants