simulation the specificity of molecular beacons by Two State melting (hybridization)

1 reply [Last post]
zhangzhang
Offline
Joined: 06/10/2015

Hi guys:
molecular beacons is a self complement nucleic acid contained stem and loop regions first reported by Tyagi and Kramer in 1996, and have potential to discriminate point mutation. Input the same sequences as Tyagi and Kramer used in 1996. The nucleic acids sequences are as followings (From 5'-3').
Molecular beacons: CGCGAGAAGTTAAGACCTATGCTCGCG (we add a C-G base pair at stem region to compensate the affinity of quenching and fluorophore )
Target: CATAGGTCTTAACTT
Point mutation: CATAGGTGTTAACTT
Paramters: Energy rules:DNA; temperature:25;Na:10mM;Mg:1mM. Concentration: 1mM
For the following reaction:
Target + molecular beacons=Target/molecular duplex
Delta G1 Delta G2 Delta G3
Delta G1 and Delta G2 were calculated through Quick fold, Delta G3 was calculated through Two State melting (hybridization).
So the Delta G of the whole reaction can be expressed to Delta G =Delta G3-Delta G2-Delta G3.
The results for target/molecular beacon are: Delta G1=0.16Kcal/mol, Delta G2= -5.77Kcal/mol, Delta G3=-15.3Kcal/mol, and Delta G= -9.69 Kcal/mol= -40.7KJ/mol

The results for point mutation/molecular beacon are: Delta G1=0.09Kcal/mol, Delta G2=-5.77Kcal/mol, Delta G3=-11.9Kcal/mol,and Delta G= -6.22Kcal/mol= --26.1KJ/mol.
From all of the above, I can calculate that both these two reactions target/molecular probe and point mutation/molecular probe can be happen in high level. That is to say, the molecular can not distinguish point mutation in target at 25 degree. And zuker have a similar results(UNAFold: Software for Nucleic Acid Folding and Hybridization Page 28). I wonder how do you think this contradiction.

stevencd2014
Offline
Joined: 07/07/2015
Hi, may be you're right. I

Hi, may be you're right. I agree a part of your claim, but the molecular can not distinguish point mutation in target at 25 degree? well, I doubt it. We can discuss it later, I will search some materials about polymerase chain reaction and the molecular basis of mutation.