For Using UNAFold to command

2 replies [Last post]
tnwl124
Offline
Joined: 04/03/2015

I install UNAFold 3.8 version.

I follow the command from "UNAFold: Softwatre for Nucleic Acid Folding and Hybridization - Nicholas R. Markham, Michael Zuker September 2, 2008" for UNAFold.pl , hybrid-ss, hybrid-min ... and so on.

I use FASTA format file following the paper.

>one
GCGAGCAGACTCCGGTGGAATGAAGGACTCGCAGGCTGATTCGGTTCATGCGGATCCA

( I try to use the File name such as sequence1.fasta, sequence1.txt and sequence1.seq making txt file)

Using Ubuntu 14.04 (same Linux) terminal, my commands are

./UNAFold.pl --NA=DNA sequence1.fasta or ./UNAFold.pl --NA=DNA sequence1.fasta
or ./UNAFold.pl sequence1.fasta

The result is

Checking for boxplot_ng... not found
Checking for hybrid-plot-ng... not found
Checking for sir_graph_ng or sir_graph... not found
Checking for ps2pdfwr... found
Can't exec "hybrid-ss-min" : No such file or directory at ./UNAFold.pl line 249.
Error: No such file or directory from hybrid-ss-min

I don't know why the program is error.

command is

./hybrid-ss sequence1.fasta

The result : stack.DG: No such file or directory

./UNAFold.pl -h, ./hybrid-ss -h and ct-energy -h are success.

Please help me....

NMarkham
Offline
Joined: 09/29/2011
This probably means that

This probably means that UNAFold isn't installed correctly. If you installed from an RPM, UNAFold should be installed to /usr; if you built from source, it could be in /usr/local or some other directory. Either way, the binaries and scripts will be in the bin subdirectory of the top-level install directory.

For any reasonable choice of an installation directory, the bin subdirectory will already be in your PATH (/usr/bin, /usr/local/bin, etc.). In the unlikely event that it isn't (say /opt/unafold/bin), you'll want to add that directory to your PATH when using UNAFold. Either way, you shouldn't be running commands prefixed with "./".

cjwang
Offline
Joined: 05/03/2016
I have exactly the same issue

when compiling using "sudo make install" instead of "make install"