Calculating energy for a section of a folded structure

No replies
srzareie
Offline
Joined: 08/27/2014

Hi
I need to calculate the delta G of a part of a folded structure. For example consider the following sequence:
GGGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGUCUCAUAGGGAACAAGAAAGAGGUUAAGUUCUAUGCGCGGGAGCCAUCA
Use mfold (or UNAFold) to fold the sequence and take the least-energy structure. What is the energy for unfolding the section stretching nt 51 to 85 ? How about nt 46 to 70 ? I especially get confused when the stretch includes part of a loop.

Thank you in advance.