UNAfold non-deterministic results

No replies
jaavedm
Offline
Joined: 07/06/2011

Hello,

I'm having problems reproducing results from UNAFold across multiple runs, using the same input sequence and parameters. For example, if my sequence is:


>seq
TTGCATATTATTTGCTCTTTGGTGATTTTAGCTGTATGGTGTTTATGTATATTCCATAGAGCTTTATTACCAAAAACCAA
ATGGTTTCTGCAT

And I run UNAFold with:

perl UNAFold.pl --model=PF seq.txt

In one run, I get the following folds:

............(((...((((((((...((((.(((((..............))))).))))..)))))))).((((....))))...))).; -19.2;
.((((............(((((((((...((((.(((((..............))))).))))..)))))))))((((....))))..)))).; -18.2;
.((((............(((((((((...((((.((((((((......)))..))))).))))..)))))))))((((....))))..)))).; -17.7;
.((((............(((((((((...((((.((((................)))).))))..)))))))))((((....))))..)))).; -16.1;
..((..............((((((((...((((.(((((..............))))).))))..)))))))).((((....))))...))..; -12.9;
.((((..............(((((((...((((.((((...(........)...)))).))))..))))))).(((((....))))).)))).; -10.8;
..(((............(((((((((...((((.((((...(........)...)))).))))..))))))))).(((....)))...)))..; -10.3;
..((..............((((((((...((((.((((((((......)))..))))).))))..))))))))..(((....)))....))..; -9.7;
.((((.............((((((((....(((.((((...(........)...)))).)))...)))))))).((((....))))..)))).; -7.1;
.((((.............(((((((....((((.((((...(........)...)))).))))...))))))).((((....))))..)))).; -6.5;

And in another run I get:

.((((....(((((...(((((((((...((((.((((((((......)))..))))).))))..)))))))))...)))))......)))).; -20.6;
............(((...((((((((...((((.(((((.((......))...))))).))))..))))))))(((((....)))))..))).; -20.2;
.((((............(((((((((...((((.((((((((......)))..))))).))))..)))))))))((((....))))..)))).; -17.9;
.((((..............(((((((...((((.((((((((......)))..))))).))))..))))))).(((((....))))).)))).; -15.9;
..(((.......)))....(((((((...((((.((((...(........)...)))).))))..))))))).(((((....)))))......; -15.7;
..(((..............(((((((...((((.((((((((......)))..))))).))))..)))))))..((((....))))..)))..; -13.9;
.(((.....(((((....((((((((...((((.((((...(........)...)))).))))..))))))))....))))).......))).; -11.8;
..(((............(((((((((...((((.((((...(........)...)))).))))..))))))))).(((....)))...)))..; -10.4;
.((((.............((((((((...((((.((((...(........)...)))).))))..))))))))..(((....)))...)))).; -8.7;
.((((............(((((((((...((((.((((...(........)...)))).))))..))))))))).((......))...)))).; -6.1;

I'm using model=PF so I can get base-pairing probabilities. Observe that the two top-folds (where the folds are sorted by free-energy) are actually different. Any ideas why the collection of folds is not consistent across runs?

Thanks,
Jaaved