Issues about Quickfold

No replies
jonny35
Offline
Joined: 01/18/2014

Dear sir,
I have some mRNA sequence as the target and their respective antisense oligo sequences. I have already used QUICKFOLD server for mRNA sequence folding using RNA 2.3 parameter. Now i wanted to fold the antisense oligo using the same RNA 2.3 parameter. Is it feasible that my antisense oligo sequence are actually DNA which i wanted to fold using RNA 2.3 server.
I have give here some sequence information about target and their respective antisense. Kindly examine the sequences and give me the feedback
TARGET sequence: GACUGAUUCUAGAACAUAGU
Antisense oligo: ACTATGTTCTAGAATCAGTC